Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E427390

Search information 
Request: 427390Match: SGN-E427390
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277013Clone name: STM-48-I22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277013 [STM-48-I22] Trace: SGN-T279528 EST: SGN-E427391 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427390Length: 634 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E427390 [] (trimmed) AAATCGGAGAATTCATCAAAATCACCGGAAAAAATGGGAGTGGAGAAGGAAGTTATCAGAGCCGGTAATGGCCCCAAACCACAGCCTGGTCAAAC
TGTTACCGTCCACTGCACTGGTTACGGGAAAGATAGAGACCTGAGTCAGAAGTTCTGGAGCACTAAGGATCCAGGCCAGCAGCCTTTCTCTTTCA
AGATCGGCCAAGGCAAAGTTATCAAAGGATGGGATGAAGGAGTACTGGGCATGCAATTAGGAGAAGTTGCTCGATTAACGTGCACCCCTGATTAT
GCTTATGGTGCTGGTGGATTTCCAGCATGGGGTATTCAGCCAAACTCAGTTCTGGTTTTTGAGATTGAAGTCTTAGGTGCACAATGAGCAATTTG
CTAACATTTGGGCAATCCTGATGGAGCTGTTGTGTACTCTATACAGTAGACAGCTTGAGGGTATCAGAACTGTTCATGTACTCTTTGCTCTAATG
CAACTTGTTGAAACAGATTAAGGCGATAATAAATGCTTTCTAGCTTTTCTCTGGATAATGGTCATACTTTGAGACTACTAATTTGCATTACAAGA
CAAATTAGTTGGTAATTAAATATAATATGGAATGGATGTAAGAGTTTGTATGGTCAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427390] SGN-U275169 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279527 [Download] [View] Facility Assigned ID: STMHH59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0059 Quality Trim Threshold: 12.5