EST details — SGN-E427721

Search information 
Request: 427721Match: SGN-E427721
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277162Clone name: STM-49-A19
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427721Length: 851 bp (950 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E427721 [] (trimmed) CACAATCTTTTTTGTAAGAACACATCATTTTCTCTTCTGTTACTTTCGTTTACATTAGATGGTAAAATGTGGAGTTTTCAGCATGTGGTATCGTT
GAGTATACAATGTTTATTCGCCTGCTAAAGAATAAGGATGAAAGAACTCTACAAAAAAAAAAGAGTTCATACAAATATATACATAACATGTTTCG
TATATCATTGCACTACAGAAGCATCTAACCTTCTTGTTAGCCAGGATTGCAGTGATTCCTTAGTTATCCTCATTTTTTGCAAAACCACTGGTTTC
CTAGTTGGAGAGTGCACGTTTGCTCGTAAAATAACTCTTTCTGTATTTTCTTCCATGTTTGAATGCTTGTCCGGATGGTTTATCCCATCCTGGTT
TCTGTCATTTCCAATTCTAGATGCTGCTGAAATTACCTCAAGTCCCAAATCATGTTGCAAAAGTTTTATTATTGCTTCCTTAACAACACTTTCTT
GTCTGACAGCACGTATACCTACTTCTTGGACTCCTAGAAAGATTTGCACGTCATCTTTAATTGAATCTCCTGCAGTGTACTTCTCTCTGATCATT
CTCAAAACCGCAAGAACCACAATCCGAGCTTCAACCTTACTAAGCCCCCGGAGATTAATGGATATGCTATTTGCACTGTCCTTCTGCAAGTGTTC
TGCAACTTTGTCGAGAATCATACTTTCAGGCCCTAAATCGGTTCTATTACGAGTGCTGAAAGTTGTATTTCCTCTGATTGCCATTCTGGATTACG
CCTTCACACCACTGCTCAATTAATTGCTTGAGATAGTAATCATTGGGTTTATACCCTGCTTTTCGCATATGTTGATATATTGCTAAGCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427721] SGN-U282696 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279858 [Download] [View] Facility Assigned ID: STMHK10TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5