Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E427804

Search information 
Request: 427804Match: SGN-E427804
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277348Clone name: STM-49-K1
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277348 [STM-49-K1] Trace: SGN-T279940 EST: SGN-E427803 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427804Length: 527 bp (917 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E427804 [] (trimmed) ACTATTTTTACTACACAAAATTCCTGAAACTGCTTAATGACACCATTGCACCAAAAAAAAAAAAACCATGCAAAACTTAAAATAGAACAATTAAC
TTTTCAATCCCATCCTCACCCGACCGGAACAATAACAATATATTCAGTGTGATCTCATAAGTGGAATCTGGAGAATATAGTGCGTACGCAGATCT
CACCCTCATCGCCTTATATAATAAGGTAGAGAGCTATATTTTTGATAGACCGTTGGCTCAAAGAATTTGTGTTTTCTCGTCCCATCTTCAGTAGC
TTTCTCGTACCTTAATTAATTACATGATGGAACAAGCATTAGGATTGTCATCACTAAACATGTTGACATAGGAAGGGTCATCATATCTCGCAACA
GTACCCGTGGTTGGGTACTGATCGACCCTCCTGACGAAGCCAGGAGGCGCCTTTTTGTCATAAGCTTGAGCAGCATATGGTTGGGATACCAAATT
GTAAGGGACATAAGGCCATATCTCTGCCTTCTTTCCAGTTGACTTTGCCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427804] SGN-U274265 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279941 [Download] [View] Facility Assigned ID: STMHK61TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5