EST details — SGN-E427994

Search information 
Request: 427994Match: SGN-E427994
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277436Clone name: STM-49-O24
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427994Length: 701 bp (934 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E427994 [] (trimmed) AAACTGTGGAGGAATTGGTGTTTCTTATTGATATGCTCTTTTCATGTAATATGCAGGCACTAATCCATTTAGAATCCATTCAGTCACTCCCAAAG
AGAGTAGATTTGTTGGATTCATTGGTTGATAAGTTCTTAGTTCCATCTCCTGAGAACCCTAACATTGCAAGTGTTGATGAAAGAGAGGAATTATC
AAGCATTTTCATAGAGTTTCTCGATCTTTTTGGTGATGCAGTCTCAATTAAGAAGGCTGATGATCGGCATGCGAAACTCTTCTTACGCCATAGAT
CTTCTTCAGATTCAAAGAAACGTCAGGCTGAAGATTATATAGTTTCTGAGAAAACAAAGCTGGCAAAGTCTGCTGTTGCAACAACCAACCCTTCA
GTGGTTGGTGCATATCCTGGAGCACAGAATCAATGGCCTGCAGGTTATGGTGTACAAGGTCAAACCTGGCCACAGGCTACACAAGCCCAATCGCA
GCAGTGGAATCCTGGTTATGCGCAACAGGCAGCATATGGTGCTTACGGCAGTTATGGAACTGGCTATGCACCTCCTCAAGCGCCTGCAGCATCAG
TGCCCTCTAGTGCTGGTTATGGTGCCTATCCTTCAACATTCCCAGCCCAGGCCTTCCCTCAGCAGAATTATGCACAGCCAGCAGCCGCGGCCGCT
GCCACTGGCGCTTTGACTCCAGCACACAAGCTACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427994] SGN-U281680 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280131 [Download] [View] Facility Assigned ID: STMHL96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5