EST details — SGN-E427995

Search information 
Request: 427995Match: SGN-E427995
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277174Clone name: STM-49-B1
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427995Length: 527 bp (928 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E427995 [] (trimmed) GGACTTTGGAGGGGTTTCTTTTCCCAATTCATCTCTAATTTCCATGGCTGCTCGCACTATCTTCCTCAAACTCACAAGAAATGCTCGTGGCAGAG
AAAGGAGTCTATTTAGATCCTTTACTACAACAACTGAAGTTGTCTATGAAGACTCCCCAAATTCTTCTGAGGAAGAAAGGGGCGAAACCCCAGAT
GATTTGAAGAGCAGAATATTCAGTCTTAGACTACCCAAAAGAAGCGCCACCAACGCGCTTCAGAGATGGGTCGGTGAAGGCCGATTAATATCCAT
CTCCGACCTCCGTCACATCTCCAAAGAACTCCGAAAGTCGCGCAGATTTAAGCACGCCCTTGAGATCTCAGAATGGCTGGTTTACCACAATCAGG
ATGAAGCATTGGACTCCGACTATGCTATCCGCATTGACTTGATGACCAAAGTTTTTGGAATTGATTCTGCTGAACGGTATTTTGAAGGACTGCCT
ACCACTGTAAAAACCACTGAAACATGTACTGCTCTCCTCCATTCCTATGCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427995] SGN-U285368 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280132 [Download] [View] Facility Assigned ID: STMHM01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5