EST details — SGN-E428018

Search information 
Request: 428018Match: SGN-E428018
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277272Clone name: STM-49-F9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E428018Length: 218 bp (887 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E428018 [] (trimmed) TCACTTTCTAACAGCTACCTTATTCCCATGTTTAATGCCAGAAATTCACATCTAAAAACAAGTATTCACACACCAGCTCAAGTCACATGAGCATA
TCCTTTTTCACTGTATACACTGGAGGATCGATCCTATGTTTCTCGTCTTCCTTTCAAGACGGAAATCAGTCTTACAGGAGATGGTTAAAGATCAC
AGATGCGGAGAAATACCTTCGTTTACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E428018] SGN-U282101 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280155 [Download] [View] Facility Assigned ID: STMHM29TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0153 Quality Trim Threshold: 20.5