EST details — SGN-E428389

Search information 
Request: 428389Match: SGN-E428389
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277461Clone name: STM-50-A16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277461 [STM-50-A16] Trace: SGN-T280527 EST: SGN-E428390 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E428389Length: 746 bp (958 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E428389 [] (trimmed) AATGAGAAACGATGTCCAGAGTTTTGTTGCATCCTGTCAAATTTGCCAGCAAATGAAAGATGTGCACCACCATCCAGCAGGTCTATTGCAACCAT
TGCCCATTCCAGATCTGGTATTTGAAGATATAGCTATGGATTTTATCACGTGTTTGCCTAGTTCGAAAGGCAAGTCTACTATCTTAACTGTGGTA
GACCGGTTGACAAAATACGGTCATTTCATTCCTTTATCTGCCTCATTTTCCACTCGAATTGTTGCTGAAGCTTTTGTGGTTGGGATTATTCGCCT
TCATGGTCCTCCACGAACCATTGTCACTGATCGTGACCCCAGGTTTCTACATTCTTTTTGGCAAGAAGTCAACCGATTACAAGGGACGTCTTTGG
CTATGAGTACAGCGTACCACCCCCAGTCTGACGGTCAATCAGAGGCTCTGAACAAGTGTGTTGAGCAGTATCTTCGTTGTTATGTTGCTGATGCA
CCACATTGTTGGGTTGCAATGTTGCCATGGGCTGAATATTGGTACNACACGGCGTATCAGACCTCCGCTGGCATGTCCCCATTTTAGGCCCTTTA
CGGAAGAGAACCTCCCACCATAGCACGTTATGTGTCAGGCAGCAGTCCTAGCGAGCTAGTGGAGGAGTATTTCGTTGATCGTGATAAGGTTTTGA
GCCTTTTAAAGATCAATTTGCTTAAGGCACAGGGGCGAAATGAAAAGTTTGCTGACNAACATCNGACTGAGCTTGAATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E428389] SGN-U284869 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280526 [Download] [View] Facility Assigned ID: STMHP08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.995 Expected Error Rate: 0.0156 Quality Trim Threshold: 14.5