EST details — SGN-E428555

Search information 
Request: 428555Match: SGN-E428555
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277573Clone name: STM-50-F3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277573 [STM-50-F3] Trace: SGN-T280693 EST: SGN-E428556 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E428555Length: 533 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E428555 [] (trimmed) AAATGGCAAAGATAAAAATAATTGGAATTGAGGAGGTAAAACGAAGTTCCTATGGCCAACTTGTATTAGGCGAAGGGGTGGCATCTGACCTAGGT
GAGCAACTGGCTAAAGAAGCAAGAAAAGCAGGTAAATTTCCTCAGACAATCTGGTTCAATTTCATTGCACAATCTGCTAAAATATCATGGCATAA
GCTGGTTGCCTCTCTTTGTACCATATTTCAACATAAGAAACTGCACACCTCCTCTATATTATTTTGACCCAGTTTCCGCTGAGGAGCAAAGAATT
GCTAAGGAGGTTGCTTCCATACTAAAGTTGACTGTCGACATTGATACTACTTCAAGTGAAGGATTGCAGAATGTTGTGGCTGCACTGAGGGCTGG
GGCAGAATATGCCGATGTACCTGTGCACAATTGTGTGCTTGTTTCCGGAAGTCTATCTGGTGTTGCTGGAGCAGAGCGAATTGGCATGCCTTGCG
TTGTGGTCCGGAGCAGTTCACGGCCAGAGCTGAGTTTCCGGAGCTAAGCAATAATGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E428555] SGN-U275464 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280692 [Download] [View] Facility Assigned ID: STMHQ26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5