Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E428592

Search information 
Request: 428592Match: SGN-E428592
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277608Clone name: STM-50-H23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277608 [STM-50-H23] Trace: SGN-T280728 EST: SGN-E428591 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E428592Length: 789 bp (910 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E428592 [] (trimmed) AAAAAACAAAAGGGGGACTGTCAACGCCATCCACTCGTACTTTCATTTAGTTTTAAGCAAATTCCTGAAATACAATAACTAAGACAAAAGCTGAA
AGAACCTCAAAATGACAACTGTCATAATCTACAAGATACAGCCGAAAAGATGCAGCAATTCTGCTACATCACCTAATTGAACTGCACAAATGTTT
TGGAATAAATAAAAGAATGCTTAGTCTCCCCCCTGAGTCCATACCTTCACAGTCTTGTCATTCCCAAGAGAACCAGAAGCAATCATGTTCTGAGT
GGGGTTGCATGATACAGAAATCACAGTATCAGTATGGCCTTCCAATTTTTGAACTATCTTCCTTGATTGGAGTTCCCATAAATATACACAATTAT
CCTCAGAACCACTAACGATATACTTCCCATTTGTTATGGAAAATGTTGATGAAATGCAGTACTTTGAGTTGACATGGTCCGTGTAAGTTTTCAGA
ACTTTTCCTGTCGAGAAGTTCCAAAGCCTCAGAGAATTATCCAAAGTGCCAACGAGTATAAATTTGCCATTGGGCGAGAACTTGACGAAGCTCAC
AGGTGGGTTTTCATCATCAATAATGGTCTTCATACAATGCCCGGTTGAAGCATCCCAAATTCTGCACAACCCATCATAGCTGCTTGACACAATCA
ACGAACCATCCCGATTAAAATTCACAGCCGTCACAGGATCGGAATGCGCCGGCAGCACCTTGAGAACTTCCCAGTCTTCACATCCCATAACCTAA
CCGTCTCATCGAACGACCCAGAAACAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E428592] SGN-U275933 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280729 [Download] [View] Facility Assigned ID: STMHQ48TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0091 Quality Trim Threshold: 14.5