Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E428597

Search information 
Request: 428597Match: SGN-E428597
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277648Clone name: STM-50-J7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277648 [STM-50-J7] Trace: SGN-T280735 EST: SGN-E428598 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E428597Length: 565 bp (919 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E428597 [] (trimmed) GTCAACCTAGGGTTGTGGGATACTGCTGGACAGGAGGACTACAACAGATTAAGACCTCTGAGTTACCGTGGGGCCGATGTTTTCATTTTGGCATT
CTCTCTCATTAGTAAAGCCAGCTATGAGAATGTCTCCAAGAAGTGGATTCCTGAGTTGAAGCACTATGCTCCTGGTGTCCCAATTGTACTTGTTG
GAACAAAACTTGATCTTCGGGATGACAAGCAATTTTTCGTAGACCATCCTGGTGCTGTGCCGATTACTACTGCTCAGGGTGAGGAGCTAAGGAAA
ACAATAGGTGCACCATCTTACGTTGAATGTAGTTCAAAAACACAACAGAATGTGAAAGCTGTGTTTGATGCTGCCATTAAGGTCGTCCTCCAGCC
TCCCAAGACGAAGAAAAAGAAGGGGAAATCTCAAAAGGCCTGCTCGATATTGTGATCAACTACAGGTCCAACGATAATGGCTCATCATAATTCCC
GTTGTAACATCCCCCCCCCCCTTATATCCCTTTGTCTCGGAGGAAGTAGAAGGTTCTCATCTGTCCTATTTGGAACTACTAACGATCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E428597] SGN-U271453 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280734 [Download] [View] Facility Assigned ID: STMHQ52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0066 Quality Trim Threshold: 12.5