EST details — SGN-E428658

Search information 
Request: 428658Match: SGN-E428658
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277756Clone name: STM-50-P15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277756 [STM-50-P15] Trace: SGN-T280794 EST: SGN-E428657 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E428658Length: 575 bp (897 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E428658 [] (trimmed) ATGCTTCTTTAAGATTCATCAAATGGTGCAATCAATTACATATCAATATTTGCTGGTAATGACCCAGAAAACTGTACATATGTGAATGTTTGAAA
AAAATCATATACAAACAGAATGCCTGGTATGTACTACCTACCTAACCTAAGTAATCTTTATCAATAATTAGGATGATAAGAGACAAGTGCTGGAT
CTGGATAGACGACAGGCAATTTATCGATGTACATGAGAAGCCTCTTCATATTTTCCCTCGTTATTGTGGACAAGTCTTTGATGTCACATATGTTG
GTGTATATCCAAAGCTCTCCGGAATCCACCCTTTTGAGACTATCTCGACAGAAAGGGCATGACTGAGATCGGGCACGCCAATTTCTATAACACTT
CATGCATAAAGAGTGATTGCAGGAGGGCAAGACAACCTTTGTATCCATCTCCATGCAGATACCACATTCCTCCTCCCTCTCTATTTCGATTTCAG
ACAGCTTACCTTTGCTCGTCTCATCACCTCTTGTGTATTTGGTTGCGCATATCTCTCGTTGCTTCCTTTCATCAATGTCAGTGATTCCCCTTTGA
AGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E428658] SGN-U272075 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280795 [Download] [View] Facility Assigned ID: STMHQ92TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0052 Quality Trim Threshold: 20.5