Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E429042

Search information 
Request: 429042Match: SGN-E429042
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277894Clone name: STM-51-G16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277894 [STM-51-G16] Trace: SGN-T281178 EST: SGN-E429041 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429042Length: 409 bp (993 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429042 [] (trimmed) CTATTATATCAAAGAAAATATTTTATTTACACAAACCCCCAACAACTCCTCTAGATTAACATATACAATTTTTTATTTCAAAAAGTTTAAATTAA
AATATGTACTAAAAACAAAGCACCAATAATATGTGACAACAACTACTCACTAACACTAGTCTAGTACCCTACTTACACTCTACTTTACCAAAACC
AACTCTTTTATTACTCAAATCAAATTCAACCCACAAATTTTGTTGATGAAAATTACCAATAATATTACTTGCAATTCCAAGTGATTGTGATCTTC
CAATCCCCACACAATGAACTCCTCCACCTACATCATCCAACACATTCTCTTTATTGATCAAGATTTCAACTCCATTTTCAAATTCCAACGTCATA
TCACCTATCGCTTGACCAGCTTGTACTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429042] SGN-U280121 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281179 [Download] [View] Facility Assigned ID: STMHT44TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.891 Expected Error Rate: 0.0050 Quality Trim Threshold: 20.5