Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E429158

Search information 
Request: 429158Match: SGN-E429158
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277914Clone name: STM-51-H15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277914 [STM-51-H15] Trace: SGN-T281296 EST: SGN-E429159 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429158Length: 704 bp (876 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E429158 [] (trimmed) CAAATATCTTCTTTTCCTTCATCTCCTCTTGTTCTTAACCATGGCACTTTGGAGAGAGTTTATAGCTACCTCCTATCTCAGGCTTTGATGAAAGG
AGAGAAATAAACTATAACATGCTTTTATATGGCAAGAGACACTTAAGTTTGCAGACACAATGGGAGTAATAGAGTGAAAGGTTTGGGTTTTCACA
TCTAAAGGCTATGGATCTTAGCCAATCTTCATAGTGGGTTTATTCAGCTATGGGATCACCTTATCGGAACTCTCATTGATCGATTTGATGAGCAC
GATGGCCCTGTTTGTGGTGTCCATTTTCACAAATCTCAGCCTCTATTTGTTTCTGGAGTGCAACAACATCTGTAAGATTAATTCAAAAGGGTCTA
TTTCATTGCTATTGACACTTTTCTTTCTTTCATCTTCCTAATTCCTCTGGTAAGCTTCATGCCAGTCTGACTAAGAGCTGATCTTGCAAAAGGAG
TACAGTGCGACAACAAGCGAAAATCAGCAAACAGATTGCCAGTCTCAGGTGTTCTTCAAGATTCTCATCTACAACTTCAGTTGTATGAAAACAGA
GACACTATCTCTTACCTATTTGCAAATCAGTTTTTTGGAATGTTACATATCCCTACTCCATATATACTGATCTCCACATAGAAGTACCTTGCTAG
AGTACCAACACGAATTTCAGCCTTCTAATGGAGCTGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429158] SGN-U278126 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281295 [Download] [View] Facility Assigned ID: STMHU44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5