EST details — SGN-E429229

Search information 
Request: 429229Match: SGN-E429229
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278084Clone name: STM-51-P17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278084 [STM-51-P17] Trace: SGN-T281365 EST: SGN-E429228 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429229Length: 731 bp (952 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429229 [] (trimmed) TTTTTTTTTTAGCAGAAAATCTAACCGCTTCTCTCATTGAATTTTACAATACAAATTCGTTAGCTATCAAATATTCAAATAATATCTCAACAAAC
CGATCAAAGTTAACAATGGAAAATCTTTTCAATTGGTCTCAGCAAGATCGCCCTCGCTATTCCTCGAGAGGAAAACCAGTACAATCGGTCCATCA
GAAATCTGCCGGAATCAAGCCGGCGACGAAGGTTGTTCAGATTCCGGTCCACTCCGTCAGTTCGGATCCAGATCGGTCCTCCCCGACACAGAAAT
CTGATGAGGTAGCGCAGGCGCCTGATAGAAGATCCGCTTCAGCGTTAAGGATCCAGAAGGTATTTCGAGGTTATATGGTGAGGAAAAACGTGAAG
AGAATTATGTCAATACGAAAAGAGGTGGATGAAATTGAGCGGAAGCTTTTATGCGGAGAAACGGCGGAGTTGATTCGGAGAGACGAAAGGGAAAG
GTTGCGGGTGAATGAAACGCTGATGTCTCTGCTTTTCAAGTTGGACTCCATTCGTGGAGTTGATTCTGGTGTTAGAGAGTGCAGAAAGGGTGTGA
TTAAGAAGGCCATCTCCTTTGCAGAAAAAGTGACTCCATTGTTCCCCCGCAGCTAATTAATTGCGAATAGAGTGTGCGTAGACCTTACTCTCATC
TCGTAAAGCAGGGGTGTGGGTGCAGAAAATCAAGCAAACATCGAATTGTACTAAAAATGATGAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429229] SGN-U271603 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281366 [Download] [View] Facility Assigned ID: STMHU93TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0160 Quality Trim Threshold: 12.5