EST details — SGN-E429650

Search information 
Request: 429650Match: SGN-E429650
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278386Clone name: STM-52-M6
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278386 [STM-52-M6] Trace: SGN-T281788 EST: SGN-E429651 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429650Length: 531 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E429650 [] (trimmed) GTCATTGTCCCATATCCACCTAACCAACTTGTTATAATATTCCCCCATCCCCATAAAACCCACAACACAAGTCTCTCTATTTATATATTTGCTTT
CTCCCAAAGATAAGTGAAAATTCGATCAATCGAGAGAATTTATAATATGGGTGTTCTTGATTATTTATCAATTTTTTGCACCGTTACAAGTAGAA
GACGACGTACCAAAAGGAGACCATTACAGACAGTGGAGATAAAAGTGAAGATGGACTGTGATGGATGTGAAAGAAGAGTCAAGAACGCAGTTAGA
CGCATGAAAGGTGTGAAAACAGTGGAAGTGATTAGAAAACAACACAGGGTGATAGTGAGTGGTTATGTTGATCCAGCGAGAGTGTTGAATAGAAT
AAAAAGCACTGGAAAAAGAGCAGAAATGTGGCCATATATTCCATATAATTTGGTGTCTTATCCATACGTAGCTCAAGCATATGACAAAAAGCCAC
CTTTCTGGTTTTGTTAAAAATGTGCCACAAGCACTAATTACACCTAATGCTACTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429650] SGN-U274780 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281787 [Download] [View] Facility Assigned ID: STMHX75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5