Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E429715

Search information 
Request: 429715Match: SGN-E429715
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278173Clone name: STM-52-D19
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429715Length: 631 bp (901 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E429715 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGGCTTAACACATTGATGGTTTCATTCATTGGTCAAATCATTTGGATACACAAATACAAACATAAA
CCCCAAAATCTACTAAACAGCTAAGAAAACACTAGCAAATCCTTAATACTATTCCAGAAAAAGAAGTACAAAGCTATAACTAAGAAAAACCAAGT
CTTGAACGGGTTTAATCTTCATCAGCAGATGGGTTTGAACCACCAGTTTTCTTTGGAAGCAAAAGGGTGGGAATGGTGGGCATCACACCACCATT
GGCAATTGGTACATCTCCGAGAAGTTTGCTTAGTTCCTCATCGTTCCTCACTGCCAATTGAATATGCCTTGGAACAATCCTAGTCTTCTTGGTGG
CCCTTGGTGCATTTCCAGCCAACTCAAGAACCTCAGCAGCAAGGGACTCCAGAACAGCAGCTAGATAAACCGGAGCTCCAGCACCGACACGTTCA
GCATACTTCCCGGGTTTCAAAAACCGAGCAATACGACCAACAGGAAACTGAAGACCAGCTTTGCTACTACGAGAAGTAGCCTTTTTTGCTGTTCC
TGAACCTAGGGGTTTGCCTCTACCAGCCATTTATGGAGAATCTTTTTGAGTTTTGAGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429715] SGN-U285080 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281852 [Download] [View] Facility Assigned ID: STMHY22TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0068 Quality Trim Threshold: 12.5