Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E429731

Search information 
Request: 429731Match: SGN-E429731
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278213Clone name: STM-52-F13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278213 [STM-52-F13] Trace: SGN-T281869 EST: SGN-E429732 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429731Length: 761 bp (907 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E429731 [] (trimmed) AAAACGCGTAAACTGAGAAATCCAGAGCTCAACTGAGTGTTGTTCAATCCAAAAGAGTTTTGTTTGCTTTCGATTCATCTGATTCTTCAGCTACA
GTGGGTCAGTACTCTTTCTTGAGAAACCCCACACACCTACCCGCACAATTCACAGAAAAAAATTGTTAAAAAAGAAAAACTGCTTAGACTTCTCC
TATAAAGCTGCTGCAGTCCCTGAATTAACTGGGTGATTGTGAAGAGCAGAAGAATTTTTCATTCTGGTGAACTCATACTTGCACTGCTTAAGACT
TTTGCATCCCATGTTTCCTATACTTATCTCTCAGTCAGTGGACTTAGATGGCCATTTCCTCATTGGGGCTACACCGGAAAAGCCAAACTAACCAG
TTTCAATTATTAATGGAGCAAGCAGATAACCGTAGCAACAATGAGCATGTTATTGACATAACTACTAGCAACGATGCATCCTCATCTAGCAACCC
CCATGATAGACCAGTTAATAATGTGCTTCATGTCCAAGCTGAACATCCCCCATCAACAAGCACAACAGTGCCCGTCTCCCAACATGCATTTTCTT
CTGCTAATAGATCCAACTTGAGGAACTCATCATTTGCTCGAAGAGGAAATGGGCGCCGCCATCGGAGTCCTCTGAATTCCGTGCTCTGGATATCC
ATTGAACTAGTCTTGACAATGAGCCAAATAATTGCAGCAATCGCGGTGGTGGCCATATCAAGGGATGAGCACCCACGAGCTCCTCTATCCCAATG
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429731] SGN-U282071 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281868 [Download] [View] Facility Assigned ID: STMHY31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5