EST details — SGN-E429885

Search information 
Request: 429885Match: SGN-E429885
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278230Clone name: STM-52-F8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278230 [STM-52-F8] Trace: SGN-T282021 EST: SGN-E429884 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429885Length: 491 bp (893 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429885 [] (trimmed) CTCTTTTTTTTCCTCAAAAGAAATCAAACTATACAAAACTCAAATGCAGAAAAAGAATATTAGAATATGCTTTTTCTTAAATTACTCAACTCATA
TGTACAGAGAAGAGAGCTACAAATGAGAAAATTGGGTGAGACTTCAGGACTTGCAATTGGAAAAACTCCTATCAACTAAGTATGATACACAAGGG
GGTCAGGGGCCAAGGCCAATTGGACTTTGGGGAACCTGAAATGGATTATCAACGCATGCTGATCTCGCTGTTATCTCGGGTTGCAGAACAGGGAA
ACAAATAAACCAATGCCTTGCTATAAAGTTATACATATCTCCTCTACATGAAGTAACTGAGAGATGTTTTCTTTCTTGATCCACCTTCTCCATAT
AAATCATTCCACTGGAGAAGCTCATTCATATTTGAAGATTCTGATGATACACTGGCACATACCTGCTCATGTGCATACTTAAAATCATCCATGTT
AAGAGGACGAATGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429885] SGN-U276315 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282022 [Download] [View] Facility Assigned ID: STMHZ28TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0059 Quality Trim Threshold: 12.5