Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E429950

Search information 
Request: 429950Match: SGN-E429950
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278354Clone name: STM-52-L18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278354 [STM-52-L18] Trace: SGN-T282086 EST: SGN-E429949 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429950Length: 824 bp (896 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429950 [] (trimmed) ACATTTTTTTTTTTGNGAAACAAATATTCTTTTGGAGGCCAAAAGAGTGCATTGAATAAGAACATAACAAGGACTATACCACAATCCCAAGCAAG
TTGGGATCGGCTATTTGAATCCTCAACTACACACGAAAATCGAGAGCTAACAAATCCATCTTTACGACTAGTAAATAAATTATGATCCACAGAGT
CAACATGTTTCTTAGGGGACATCCGATATAATTGGAACAGGGTGAGCTATTGTTACATTTGTTGTGCTAATGCATCGGAAATAATCATCAGAACT
TCCCTCTCCAGTAAAAGGAAGAGTGAACTGACATTATCACCCGAAAGAATATGTTAAAAGGAAACTTTGCACATTTGGTACAGCAGGAGCAAAGC
TATAGGACACTTTGCAATTTTGGATTGTAAGAATATGTCGCGTATCAGCTACTGAGGTTGAATCATGTATATCTTTATTTCGACAGCTTAAGACC
TGATTAAGCAAAGTTACAAAATCCCCAATCTTCTTTTGACAAGTCAAGGTGCTCAACACTACCGTCTTCAAACATGATCAAATGTTTTTTGGTGA
TGCTGTCAAACTGTTTTATGATTCCAAAGGAACTGGAAACATCGGGTATTCGAGACTCCAGTGAATCAACAGGACTCTGGTCAGAAGAGCGAATT
ATTCTTATAATTTGACCTGTGCAATTCCGAGGATGCTGGATTCTCCAAGCAGAGTCAAAACTCCAATTTCCTTTTGGGGGAACCTCAGTTAGAAG
ATCATGTTTTGCAGATAGCAGTACTTTCTCTTTGGGAAAGGGCGCAGCTACCTGGCATGCCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429950] SGN-U278109 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282087 [Download] [View] Facility Assigned ID: STMHZ69TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0113 Quality Trim Threshold: 14.5