EST details — SGN-E429983

Search information 
Request: 429983Match: SGN-E429983
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278439Clone name: STM-52-P16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278439 [STM-52-P16] Trace: SGN-T282121 EST: SGN-E429984 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429983Length: 492 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E429983 [] (trimmed) CTGCAGTAGTGCACTTCAGAAGATCTTCTGCTTCACCATCCACCGGCAGAGTTTATTGCAAGGTATACTATTGCAAAGAAGATGAGGTTTGCTTG
TACCAGTCATTGACCTTTGAAGTACCATTTCAAGAGGTAAATCCAGATTCTGCCCCTGCCATGATCTCACTTCCTTTTGATGTGAAGCCAAAAAC
ATCACCAACTAGCTTACAGATTCCGGCTAGGACGTGATTGATTCATCGTGAGAATACATATTACTTAATCATGATTACGTGATAAATGAAGAGCA
ACTTTCACATAAAAATCATATTTGTATGCTATAGTTATAGTTTGCATAATTGCGCTTCATAGTAAATTTTATATTTGCTATGGAGCTTTTGATTT
GTATAATTCGCTACAAACATTCAATTTTATACAAATTGTTAGGTTTTGTATAAATTCATTTATACATTGTAATTTGTATAATAAGATATGTATTT
GTATAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429983] SGN-U273467 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282120 [Download] [View] Facility Assigned ID: STMHZ92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5