EST details — SGN-E429984

Search information 
Request: 429984Match: SGN-E429984
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278439Clone name: STM-52-P16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278439 [STM-52-P16] Trace: SGN-T282120 EST: SGN-E429983 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429984Length: 511 bp (853 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429984 [] (trimmed) CCCCCCTCGAGTTTTTTTTTTTTTTTTTTTTTATACAAATACATATCTTATTATACAAATTACAATGTATAAATGAATTTATACAAAACCTAACA
ATTTGTATAAAATTGAATGTTTGTAGCGAATTATACAAATCAAAAGCTCCATAGCAAATATAAAATTTACTATGAAGCGCAATTATGCAAACTAT
AACTATAGCATACAAATATGATTTTTATGTGAAAGTTGCTCTTCATTTATCACGTAATCATGATTAAGTAATATGTATTCTCACGATGAATCAAT
CACGTCCTAGCCGGAATCTGTAAGCTAGTTGGTGATGTTTTTGGCTTCACATCAAAAGGAAGTGAGATCATGGCAGGGGCAGAATCTGGATTTAC
CTCTTGAAATGGTACTTCAAAGGTCAATGACTGGTACAAGCAAACCTCATCTTCTTTGCAATAGTATACCTTGCAATAAACTCTGCCGGTGGATG
GTGAAGCAGAAGATCTTCTGAAGTGCACTACTGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429984] SGN-U273467 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282121 [Download] [View] Facility Assigned ID: STMHZ92TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5