Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E430123

Search information 
Request: 430123Match: SGN-E430123
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278728Clone name: STM-53-M13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278728 [STM-53-M13] Trace: SGN-T282261 EST: SGN-E430124 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430123Length: 551 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E430123 [] (trimmed) CTAATGTGACAAGTGAAAAATATCATATGCCTTCTTATTTTATCATAATGCTTTGTATGTTTGGGGCTTTTTTTATGTTCATATGTTATATGATT
ATACTTAAGAGGAATAGGTCAAATTCAAGATCAATTAGGAGAAATAATGTTTCACAATTTGATGAAACTAGAGAGGATTTTGTTATAGATGAGAA
TTTGGGCCCAATTTTGGATCATCCGATTTGGTATATTCGCACCGTGGGACTTGGACAAGATGTTATTGATTCGATTTCGGTGTTTAAGTATAAAA
AAGATGAGTTTTTGATTGATGGGAGTGATTGTTCTGTTTGTTTGACTGAATTTGAGGAGGATGAGAGTTTAAGGTTGTTGCCTAAGTGTAGTCAT
GCTTTTCATATTCCTTGTATTGATACTTGGTTAAGGTCACACAAGAATTGCCCCTTGTGTCGTGCTCCTATTGTATCCGATATGGATAATTCCCC
TCGAATGGATCATGTTGTGGAAGTTGTATCGATTACTAGTGTAGGTGATGATGGCTCTAGTACGAATGATGTTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430123] SGN-U274641 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282260 [Download] [View] Facility Assigned ID: STMIA79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5