Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E430309

Search information 
Request: 430309Match: SGN-E430309
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278499Clone name: STM-53-B9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278499 [STM-53-B9] Trace: SGN-T282445 EST: SGN-E430308 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430309Length: 447 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E430309 [] (trimmed) CCGGGCCCCCCCTCGAGTTTTTTTTCCCTTTTTTTTTTTTCGCACTTTGGAAATAAATACAATTCAGTCATCAGAAACACATGAAAAGCTTCAAA
TGTACATTACAAGCAAGTAAACACATGGGGAGGGGGGGTTCTCTACCATGAGAAATCGTCTAAGTTCAACCAGAGGTAGAACATTATGATCATGA
AAAATTTGAAAAAAGAAAACAGGTTACATTTAGAGAAACCTTGTTATTCAAAGGGCCAGTTGGAATACTCAGAGTAATTATTGTGTGGATGGCTG
GTTTGTGAGCTGGTTTCAGCAGCTGGAGTACTTCGGGAACTAGAACGAGATGAACCAAAGTTCCAGAGGGAAGACCATGGTCTCCGCCTTTCTTG
GTTCTGAGAACTGTTCTCCCTAGCACTAACTCGCCTACTGCTGCTTCTGCTTTCACTCCTTGAGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430309] SGN-U273685 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282446 [Download] [View] Facility Assigned ID: STMIC05TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0074 Quality Trim Threshold: 20.5