EST details — SGN-E430407

Search information 
Request: 430407Match: SGN-E430407
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278725Clone name: STM-53-L9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278725 [STM-53-L9] Trace: SGN-T282545 EST: SGN-E430408 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430407Length: 465 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E430407 [] (trimmed) ATACTGAGACGAGGGTAGTAACAACTCTGCCCGTTGTTCGCGGTGGTTGACTCCATGGTCTTCCTATTCCTGTTACCGGTGGCTCTGTTCTTTAA
CTCGGCAGCTTCACAGTCAACCGGATATACAAACCATACTGTTGGTGGTTCAGATGGTTGGTTCTTTGACATCAACACTCAAAAGGCTTCTGCTG
ATTACTCTGCTTGGGCTGCTAAACAGACCTTTAATCTTGGTGACACTTTGGTGTTTAATACAAACACCAACCAGACAGTTATTCAAACATACAAT
GCAACCACATATAGGAACTGCACCGCGGATTATGCTTCAGATGATGACACATTTCAGTATCAAGGAGGCAGCAATGAATTTGGTGAAGCGATGAC
AGTCACTGTTTCATTGACCCTCGAGGGCCAACAATACTATTTCTCTGATGCTGATGATGGGAGTCAGTGCCTGAATGGCATGGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430407] SGN-U274108 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282544 [Download] [View] Facility Assigned ID: STMIC65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5