EST details — SGN-E430428

Search information 
Request: 430428Match: SGN-E430428
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278765Clone name: STM-53-N7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278765 [STM-53-N7] Trace: SGN-T282564 EST: SGN-E430427 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430428Length: 291 bp (852 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E430428 [] (trimmed) TTTTTTTTTTGGGGGGCTAACTTGAAATTTTTTGACGTATCACATACTGTAACAACAAAAAGGAAAGCAAAATAAAAAAGAAAAACTCTTTTACT
GGGGAGTGTAACTTTTTGGCTTATCCAATTCTTCCCCTTTAGTTTTTTTTGGTTTTTGTTTTTACATGGCGACTGCAATTCGTTTATACAACTCA
GCTGGCAATCTGGGAGTGGCAACGGCCTGTAATGGAGTCCTCATGTAGGTAACAAGTCCAGGGGTTTCACCCATATCAATCTCCTCTGGGCTCAA
TCCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430428] SGN-U273706 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282565 [Download] [View] Facility Assigned ID: STMIC76TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0073 Quality Trim Threshold: 20.5