Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E430490

Search information 
Request: 430490Match: SGN-E430490
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278523Clone name: STM-53-D10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278523 [STM-53-D10] Trace: SGN-T282628 EST: SGN-E430491 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430490Length: 615 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E430490 [] (trimmed) AGAAGAAGGGACAACTGGAACAGATCATAGATCCCAATCTTGTTGGCAAAATTAGACCAGATTCCCTCAAGAAGTTTGGAGAAACAACGGAGAAA
TGCTTAGCCGATTATGGTGTAGAGAGGCCATCTATGAATGAGGTGCTGTGGAATCTGGAGTATGCACTTCATCTCCAAGAGCCTGTCATTTAAGA
TTATCCAGAAGAAAATGGTACCATCCATGTTAGCAACCTCTCTCCATTAAGTCAATGGTTTCAGGCATGTTGATGTCAGTTCTTCTGCTGCTCAA
ATGGAGAAATCAAAGTTAGATGATCGCAGTAGTAGTCTGGGGTCCGAGGGTGGATAACTATGTGAATGAGATTTGCAGGAAGCAACTAACAACTT
CGATGAGAAGTTTCACATTGGATTGGGTGGCTTTGGGAAAGTTTACAGGGGTGTTTTGCGTGATGGAACAAAGGTGGCCCTGAAGAGGTGTAAGC
GTGAGTCCTCACAAAGTATTGAAGAGTTCCGAACAGAAATTGAGATTCTCTCTTTTTGCAGCCATCCGCATTTGGTTTCATTGATAGGATACTGT
GATGAAACAAATGAGATGATTCTAGTTTATGACTACATTGAGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430490] SGN-U268182 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282627 [Download] [View] Facility Assigned ID: STMID17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5