EST details — SGN-E430571

Search information 
Request: 430571Match: SGN-E430571
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278724Clone name: STM-53-L8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278724 [STM-53-L8] Trace: SGN-T282709 EST: SGN-E430572 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430571Length: 489 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E430571 [] (trimmed) CTTCTTTCGGGTGCAACAATAGTTGATATGTCTGTTACGGTGACTTTGGATCCAGTTTACCAGCTTCCTCCTACTGCTTTTGCAGCATCAGTGCC
AACGGGAAAGAAAAGTGCTGGTAATTCAGAATCTGCTTTTCAGAAAGCAGAAGACGTTGTTAGCAGCATGCTCGCAAAAGGTTATATCTTAGGTA
AAGATGCTGTGGGCAAAGCAAAGTCTTTTGATGAGAAACACCAATTGACTTCAACTGCAACTGCTAAAGTGGCCTCTCTCGACAAAAAAATTGGT
CTCACTGAGAAGATAAGCATTGGTACTTCCATTGTTAATGACAAAGTTCGAGAAGTGGATCAGAAACTCCAAGTTTCTGATAAAGCAAAATCAGC
ATTTTCTGCAGCTGAGCAGAAAGTTAGTACCGCTGGATCAGCCATTATGAAAAACCGGTATGTTCTCACCGGGACCACATGGGTAGCAGGCGCTT
TTAGTAAAGTTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430571] SGN-U272657 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282708 [Download] [View] Facility Assigned ID: STMID64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5