EST details — SGN-E430638

Search information 
Request: 430638Match: SGN-E430638
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278819Clone name: STM-54-A19
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430638Length: 611 bp (914 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E430638 [] (trimmed) CTTCTTTCGGGTGCAACAATAGTTGATATGTCTGTTACGGTGTCTTTGGATCCAGTTTACCAGCTTCCTCCTACTGCTTTTGCAGCATCAGTGCC
AACGGGAAAGAAAAGTGCTGGTAATTCAGAATCTGCTTTTCAGAAAGCAGAAGACGTTGTTAGCAGCATGCTCGCAAAAGGTTATATCTTAGGTA
AAGATGCTGTGGGCAAAGCAAAGTCTTTTGATGAGAAACACCAATTGACTTCAACTGCAACTGCTAAAGTGGCCTCTCTCGACAAAAAAATTGGT
CTCACTGAGAAGATAAGCATTGGTACTTCCATTGTTAATGACAAAGTTCGAGAAGTGGATCAGAAACTCCAAGTTTCTGATAAAGCAAAATCAGC
ATTTTCTGCAGCTGAGCAGAAAGTTAGTACCGCTGGATCAGCCATTATGAAAAACCGGTATGTTCTCACCGGGACCACATGGGTAGCAGGCGCTT
TTAGTAAAGTTGCTAAGGCAGCAGGGGAAGTANGCCAGATGANCAAAGAAGAAGTCGGAATGACAGAGGATGAGCAAAGACAGAAAATGGTTACT
GATTTTGCACAGGTTCATTTATCCGAGTCTCCAATAGCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430638] SGN-U272657 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282775 [Download] [View] Facility Assigned ID: STMIE10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0168 Quality Trim Threshold: 14.5