EST details — SGN-E430836

Search information 
Request: 430836Match: SGN-E430836
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279008Clone name: STM-54-K24
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279008 [STM-54-K24] Trace: SGN-T282972 EST: SGN-E430835 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430836Length: 633 bp (847 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E430836 [] (trimmed) TAAGAAAGCTTAAATGTATTTATATCATGTTGTTGGTCTATAAATTGCTGAAGATGCAACAGAACAAAAGATTAAATAATCCATTTGGAACTACT
CAAAAAAGGCATGCCCCATAATCAACTTACTCCAGTGAAAAAACTATCGCCCAGATAAAAGAAGCGACCATTTGTTCTCTCTCATTATGCGCTTT
CTAACTCAAGGATGACGGCGAATTAAACTTGTTTGTGGCATGAACTTTTCTACCAGCCTCAACAGCTTCCCTGAAAGCAGTTACGAGCTCCATAT
TGATAGGGTTGATCTGTACACCCTCATAGAAAGCATTGGCTGCCTCTTCAAACCTCTGCAATAGACGTAGAGCTGCACCTTCCCGATAACAACCT
TTTGCCCAATCTGGTCTAAGTTCTCTGCAGGCCCTGGCATCACTTAAGGCACGTTCAGCTTGACCCAGGCGGAGCCAACAAAGACTTCTATTGGA
AAACAGAGTGCCATCAGTTGGATCAAAATCGATTGCCTGTGTATAAGCATCTATAGCTGTAGCAAAATCATTCCTCTTAAATGCCTCATCTCCCC
TCGCCTTTGCATCTGCAGCTCTCTTCTTTGCTTCAGGACTCACCTCGGGTAAATCTCTTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430836] SGN-U271964 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282973 [Download] [View] Facility Assigned ID: STMIF72TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0022 Quality Trim Threshold: 20.5