EST details — SGN-E430860

Search information 
Request: 430860Match: SGN-E430860
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279082Clone name: STM-54-O6
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430860Length: 532 bp (888 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E430860 [] (trimmed) ATAATGAAATCATTTTCTCCAAATAAGATAACAATACAATCACACAAACTCACCGGTTACATAAAGAAATACTTTTTGTCATTGCATAACAAAGA
CATTTGTGAATTAAAACATCAAATTTTAGCAAAATCTAGTGATGCTTTACCAGAGGGCCTCTTACTGAAGTAATGATCCCAATAATCAGAGAACA
AAACATGTTTGTACATTGATTTTTCTCCATCTTTGAGTATTTGGGGGAATGGACCAATGACACTATCAGGGCTAGGATTCACAAATAGCGGTACA
GATATTCGAGCCCTGCTAGAATCAACTGCTACACAATGTTCGATACTCTTGTATCGATCGTTGCTCATGATTTGCAACGAGTTACCTATGTTAAC
CGCCAAGGCACCTTTGATAGGATTTACGTGAATCCAGTTATCACCTTTAGTCCCTTGGACATATAGGCCTCCCGTGTCGTCCTGGAGGAGCAGAG
TTATGCAGGACATGTCGCAGTGTCTACGAAAACCAATGGCGATATTTGGATTTGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430860] SGN-U269496 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282997 [Download] [View] Facility Assigned ID: STMIF87TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0034 Quality Trim Threshold: 20.5