EST details — SGN-E430981

Search information 
Request: 430981Match: SGN-E430981
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279089Clone name: STM-54-P13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279089 [STM-54-P13] Trace: SGN-T283117 EST: SGN-E430980 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430981Length: 491 bp (914 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E430981 [] (trimmed) TTAATTATATCATGGTTAACCTCTCTCACACTGTTGATGTATACACCAATTATGGATCCAAAGAAATTACACTTGTGACTTATCTATCAAAGTTG
CAAACCACTCTTTCCAATCCATGACCTTGTCCTCACCATTGACCACCTCGAATATCAGTCCTTTCTGTGGCACAGTCTCAAGAGCCTCTACACAG
ATGAAAGCGGCATCCTCCTTGCTCAGCTTTCCTTGTGATGCACAGCCCTCTTCAAAGTTGAAACCTTGATTTCCACCCGGTGCATTTACCAACAA
GCCAGTTCTAATAATGGTGTGAGGGATTCCCGAAGCCATAACCAGTGATTCATCTTGTTCTGCCTGTTTTCTTGCATTGGCAGTAACAATTGCTT
GAATCCCACTAGAACCTCTATAAACAGACAGCTGAGATAATAGGATTACATGTTGTAAACCTTTCCAACTCTCTAAATTTGATATAAAACCTTCA
TTTGGGCATATCACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430981] SGN-U279936 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283118 [Download] [View] Facility Assigned ID: STMIG91TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0082 Quality Trim Threshold: 20.5