EST details — SGN-E431156

Search information 
Request: 431156Match: SGN-E431156
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279122Clone name: STM-55-A23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279122 [STM-55-A23] Trace: SGN-T283292 EST: SGN-E431155 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431156Length: 644 bp (848 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E431156 [] (trimmed) ACAAACAAAATTTGTTGAGAAAATAATGCTCTTCCTAAATAAACAAAGAATCCCGTAACAATATTTAACAATAAAAATATAATACAAATAAATCA
ATCAATAGCTGTAGTGAAACTATATCTAAACCATAAATAAAAGCGTGAACTCATCAATTCCGGCGAATGAAAAAAATGCGAAATATCTCACAGAT
CAGAGATTTAAAGCATCAAAGCAGCAGCAAAGACAGCAACAACAGCAGATCCGGCGACGGCGACTCTGTTCAAGGAAGCAGAGTTTGGAGATTCA
GTAGGAGAACCTCCGGGAGCAGCGGCGATTGATGGAGGAGAAGCAGCACCGGAAGGAGACGACGACGGAGTCTCAGTAGTTGGTGGAGCTGGTGG
AGATGCCAATGGAGAAGATGCAGTAGTAGGAGCATTTGCAGGAGCAGAGACAGGTGGTGTTGATGTAGTTGAAGGAGGAGTCGCCACCGGTGACG
GCGAACTCTTCGGAGAAGCTGCCGGAGATGCTCCCGGTGCTTGTGCGAAAGCAGATCCGGCGATAAACGCCAACATTAGAGCAATGATCACCTTT
GAGTATGCCATTTTAGCTTTTAAGAGAAAAGTAGAAAAAGCACAAACAGAGAGGAGGAAATGGAAATGTGAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431156] SGN-U270651 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283293 [Download] [View] Facility Assigned ID: STMII12TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0067 Quality Trim Threshold: 12.5