Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E431194

Search information 
Request: 431194Match: SGN-E431194
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279206Clone name: STM-55-E23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279206 [STM-55-E23] Trace: SGN-T283330 EST: SGN-E431193 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431194Length: 723 bp (824 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E431194 [] (trimmed) TTTATACATACAATTTTTGAGAATACATACATTCTCAGTTCCTTCTTCCTTACCTGTTCCGATCTGTCTGAATATACATGTACATGAGCTCTTCG
CGACAAAAAAAAAAAACTCTTCCTCCTAACTTTATCCCTTTTGACTATTCATTCATCACTGGAAAGAGTAAAAAGTTGAGCAAAAAAAGAAAACC
CTCTTCTTCTTCAACACAAGCAATTGATCCATCGGTTTACTACACTAAATTTGGTCCACTATACAGTGCTCCAGCTACAGTTAAGTCCTCAGGTT
TCTCTCTCTCTTTGAGCCATGCATACTCACTTTGCTGTTCCTCTGGTACTGACAAGCCATTCACTGAGATGTTGGCAAAGGGGAAGTCATAGTAG
TATTGGCAGTGGCGACCTTCAGGATCACAATAAGGTGGGCCAAGAACATCTAGTACGGCGCAGGCTGTCTTTGCTGTGAAGCAGTGCATATTACC
TCCGTCAGCTGGATAGAGGATTGAAGTTTTGCAAGGAGCTTTAAACTTGGAATTCACCTTCAATTTTGCAAAACGCAGTCCTGTACAATCCCTGT
CAGAAATATTGGCATTTGGGGTAGTTGATTCAGGAAGGAGATTGTCCGCCCAATCATAAGACTTTATGTGCATTTTCCCAAAGAGAAGCTTGCTG
AAAACTGTCATTCCAGGATGGTTATGAAGAGGAATGACTGCTTTTGGTGGTAAGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431194] SGN-U275431 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283331 [Download] [View] Facility Assigned ID: STMII36TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0026 Quality Trim Threshold: 20.5