EST details — SGN-E431259

Search information 
Request: 431259Match: SGN-E431259
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279370Clone name: STM-55-M21
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279370 [STM-55-M21] Trace: SGN-T283397 EST: SGN-E431260 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431259Length: 774 bp (888 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E431259 [] (trimmed) GGATCATCCGTATCTGGACTTTCTGGATTATATACTGTAGCAATGAAAGCTGCTGGAGCCAGCAGACGGGTTTTTCAGATCTTGGATCGCACATC
ATCCATGCCAAAATCAGGAGACCTATGTCCATTGGGTGATCAAGCTGCAGAGGTTGAACTGGATGATGTCTGGTTTGCCTATCCATCACGTCCTA
GCCACATGGTCCTCAAGGGTATAACAATGAAACTACAATCTGGTTCAAAGGTTGCACTGGTTGGTCCAAGTGGTGGTGGAAAGACTACAATAGCA
AATTTGATAGAGAGATTCTATGATCCTGTTAAAGGGAAGATCTTGCTCAATGGGGTTTCTCTGGTTGAAATATCTCATAAGCACCTACACCATAA
GGTTAGTATAGTGAGCCAGGAACCTGTTCTTTTCAACTGTTCCATCGAAGAAAATATTGCCTATGGATTGGGCGGCAAAGTAAGCAGTGAAGATA
TAGAAAAAGCAGCTAAAATGGCTAATGCTCATGAATTTGTATCCAAATTTCCCGAAAAATATCAAACCCATGTCGGAGAACGAGGATTGAGACTT
TCTGGTGGTCAGAAACAGAGAATTGCCATAGCTAGAGCACTGCTGATGAACCCTACAATTTTATTGTTGGATGAGGCCACGAGTGCTCTGGATGC
TGAAAGTGAATATCTTGTTCAGGATGCCATGGATTCCCTGATGAAAGGTAGAACCGTTCTTGTCATAGCTCACAGGCTTTCAACAGTCAAGAGCG
CGAATACTGTAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431259] SGN-U272654 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283396 [Download] [View] Facility Assigned ID: STMII83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5