EST details — SGN-E431307

Search information 
Request: 431307Match: SGN-E431307
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279123Clone name: STM-55-A24
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279123 [STM-55-A24] Trace: SGN-T283445 EST: SGN-E431308 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431307Length: 708 bp (917 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E431307 [] (trimmed) GAAAATGTCGGACGGAGGATTGACGATTTTGGACGGAACACAGCTCAGAGCCGTTGATCTATCGTTACCGTCGCCGGCCGACAGTTCAGTAACTG
GTGCTCAGCTTCTTGACGTCGCAGAATCGAAAGTTTCAGAATCACTCTTCGGCTTCTCATTGCCGGATACTCTCAAGTCCGCCGCTCTTAAACGC
ATCGGCGTCTCCGATGACCTTGAATTCCGCCGTGAACAGCTCGATCGTGAAAACGCCTTGTCTGTGCTCCGGAATTACGTCGACGCCATTGCGAA
TGAACTCCAAGATGATCCTATAGTCATTGCAATTTTGGATGGGAAAACTCTTCAAATGTTTTTGGAAGATGAAGATGACTTTGCCATGTTGGCTG
AGAATCTTTTCACAGATTTAGACACAGAAGATAAAGGAAAGATCAAAAGAAATCAAATACGGGATGCTCTCTTTCACATGGGTGTCGAAATGGGA
ATTCCTCCTCTTTCAGAGTTTCCTCTACTAAGTGACATTTTAAAGAGGCATGGAGCTGAAGGAGAGGATGAATTGGGGCAAGCCCAATTCGCACA
TTTACTTCAACCTGTGCTTCAGGAGCTGGCAGATGTTCTTGCTGAGAACCCTATGGTTGTGTTGCAGANNAATCAGATCAATAATGGTTCCAAAT
TGAGAAAGATTTTGGCTGATGAAAAAGCACTAAGCGAAACAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431307] SGN-U275505 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283444 [Download] [View] Facility Assigned ID: STMIJ12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5