EST details — SGN-E431308

Search information 
Request: 431308Match: SGN-E431308
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279123Clone name: STM-55-A24
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279123 [STM-55-A24] Trace: SGN-T283444 EST: SGN-E431307 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431308Length: 494 bp (902 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E431308 [] (trimmed) GGTGTATTTGAAGGCGCATCAATATACCTTCAATTGTCAAGATCATGAATATTTGGGTTAACTTCAAGTTGAGCTGCAAACTTCTCAAGGATCTC
CTTCAGAAAAACCAAGAATTCGTCCTTCTCTGATGTTTTTGCATCAGTGTTTCCATTTTCTATAGCACCTAATACGGTATCATATAGAAGAATCA
CCACTTCATCATTCAGAGGTGGCAAGCCCAATGAAGCTCCATTTTTCTCGAGATAGTGTCGAATGACGTCTTTTGTACTTAGACCGTCTTTCTCT
TCCTGCATTATCTTCTCTACTGTTTCGCTTAGTTGCTTTTCATCAGCCAAAATCTTTCTCAATTTGGAACCATTATTGATCTTGATTTTCTGCAA
CACAACCATAGGGTTCTCAGCAAGAACATCTGCCAGCTCCTGAAGCACAGGTTGAAGTAAATGTGCGAATTGGGCTTGCCCCAATTCATCCTCTC
CTTCAGCTCCATGCCTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431308] SGN-U275505 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283445 [Download] [View] Facility Assigned ID: STMIJ12TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0032 Quality Trim Threshold: 20.5