Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E431363

Search information 
Request: 431363Match: SGN-E431363
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279243Clone name: STM-55-G18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279243 [STM-55-G18] Trace: SGN-T283501 EST: SGN-E431364 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431363Length: 755 bp (871 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E431363 [] (trimmed) CTTTATCTGTGTAAAAACACGAGTTGAGGCCGAGGGATTGCGTAGTGGTGCCGCCGCGGCCGGAGTCCGAATTCCGATGGCGAACAACAACAACA
ATCAACCAACGACTCCACCCTACCTTCCCTACCGCCAGAAAAAAGTTCTCACCGGACATACAAGCGCCGTCTCTTGCGTGAAGTTCGCCAATAAT
GGTCAACTCTTTGCTTCCGCCTCCTTGGACAAAACCCTAATCGTCTGGTCCACCCAAACCCTAACTCAGCTTTCACGTCTCGTCGGCCATTCCGA
TGGCGTCTCCGACCTATCATGGTCATCTGATTCAAGTTACATATGCTCCGCCTCTGACGATCGTACGCTCCGTATATGGGATGCACGAACAGCTG
AGTCAGTCAAAACTCTCCGGGGACATACTGGCTTTGTCTTCTGCGTTAATTTCAATCCTCAGTCCAATTTCATAGTTTCGGGTTCGTTTGATGAG
ACTTTCCGGGTCTGGGATGTGAAAACGGGCAAGCCAATCCACGCGATTAGGGCACATTCGATGCCAGTTACTTCGGTTCATTTCAACAAAGATGG
GTCGTTGATTGTTTCGGGTAGTCATGATGGGTCTTGTAAGATATGGGATACGGCTTCTGGAGCCTGCCTCAAGACTCTTATTGATGATAAGGTTC
CAGCAGTTTCCCTTCGCCAGTTTTCACCTAATGGCAAGTTTATTCTTGTTGCCACCCTAGATAATACTCTTAAGCTATGGAACTATTCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431363] SGN-U270957 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283500 [Download] [View] Facility Assigned ID: STMIJ45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.990 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5