EST details — SGN-E431399

Search information 
Request: 431399Match: SGN-E431399
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279318Clone name: STM-55-K12
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279318 [STM-55-K12] Trace: SGN-T283537 EST: SGN-E431400 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431399Length: 455 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E431399 [] (trimmed) GCAGTACAGATTTGCTAAGTTGTTTTGAGTTTCTAAGGATATGTTGCTAATTATTAAGTGGCCCGTAAACTTTAGCCTCTAGATTTTTTATTCTC
GATGGGATTGTCTGCTGGCAACACACACCTTTCAGATAAAGTTGGAAGCAGTAGCACTGAATTGATTGTTAATACTCCACAGGCATATTCAGATA
TGATTGAGGAGAGAAGAAAGAGGGTGACAAACGGTCTAGAAGATACATATGGAGAGAGGAAAAGCCAGTAACGGACGGAGCAGGAACAACGCTGC
GTGCATACGTAGATTCATTTCACAATGTTTGCATTTTAAAACTGCGAGTCTAAGGACCCAATAGGGAGATCAATGTAGCTTAAATTTTTGTACTT
GCTGTAAATGTCAGACCCCTGGAGAACTCTTCATATGAATGAAAGAAAACAACACATTCTATTCAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431399] SGN-U270958 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283536 [Download] [View] Facility Assigned ID: STMIJ66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5