EST details — SGN-E431493

Search information 
Request: 431493Match: SGN-E431493
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279221Clone name: STM-55-F19
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431493Length: 321 bp (893 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E431493 [] (trimmed) GCAAGATGGCAGGCCCATTTCAGGAAGTTGCCTTCAATACCCCTGTTGGAGCTACCAGTGCACCCTTTAAATCAACACATGGATACCATTTCATT
TTATCTGAAGGGAGGAAGAACTGAGATCTCTGAGCATTTAGATAGACATGGGATGGTGGCAGTTGTAGCAGAGAAATGACTATTTGGTCATCTGA
TACTTATTGCTGAGACTATCTTCTGGTTAAGTTAATAAAATGCAACTGGTGTGTGGATTGCAAGTGTAATGATAAACAAGTAAACATGTCAATGA
TTGGATCAAAGTATCTTACTGGCTCAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431493] SGN-U273051 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283630 [Download] [View] Facility Assigned ID: STMIK34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5