EST details — SGN-E431561

Search information 
Request: 431561Match: SGN-E431561
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279384Clone name: STM-55-N13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279384 [STM-55-N13] Trace: SGN-T283697 EST: SGN-E431560 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431561Length: 185 bp (1055 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E431561 [] (trimmed) TAATAGTAATATGTGGTGAAATCACGTGAAGTTGATAAATTGAAGGATTTATGTGACGTGGTTATGTCCCTTTTCTATGGGGAGTTAAATTATTT
GATTTAATTAATCTGTAACCATACTTATCCTTTTTTATAATGTTAATCATCAACCAAAAACACAGGTATCTAAATAATAACTACTTAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431561] SGN-U280562 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283698 [Download] [View] Facility Assigned ID: STMIK79TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.892 Expected Error Rate: 0.0060 Quality Trim Threshold: 20.5