EST details — SGN-E431655

Search information 
Request: 431655Match: SGN-E431655
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279274Clone name: STM-55-H4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431655Length: 634 bp (872 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E431655 [] (trimmed) GTTTGCCACCTTCAGGAGTAATTCCTCTTCATAATCATCCTGGCATGACTGTCCTCAGCAAGCTTCTATCAGGAACCATGCACGCCACGTCATAT
GATTGGGTGCACAATCACGACCACCAGGCTAATCATTGTAAGAAAAATCTTTAATTTTATATATATAGAATTAATTAACATGATAATTAAGTAAT
TTACTACTCCTTCCGTTCACATTTAATTGTCATGGTTATCTTTTTTAGAGTCAAACTATAAGAACTTTGACTAACATTTTACGATGTACTTTTTC
ATCATATTGATATACAAAAAATTGCAATTTATAGCACTTTTCGTATAGTTTTTAAATATCTAAAGTTTTTATTTAAAATATTGAATTAATGTAAT
CTAAATTAACTTTGAAAATTAGTCAAATTAACTTTTGAAAAACGCAACATGACAATTGAAGGTGGACTTAGTGCATAATTGACACTAATTAATAG
AGCATGCGTCGATTTTTATATAGTATAAATAATGTTTACACTATAAGCACTAAAAAGTTAATTATGTATCAAATTAGTTAGTTGCTTTAATATTA
CCATTTATTATAGCTAGCTAGCTAGTTGTACTATATATGTATAAGCCTGATCCGTCTTTTTCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431655] SGN-U277519 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283792 [Download] [View] Facility Assigned ID: STMIL38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5