EST details — SGN-E431941

Search information 
Request: 431941Match: SGN-E431941
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279464Clone name: STM-56-A22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279464 [STM-56-A22] Trace: SGN-T284079 EST: SGN-E431942 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431941Length: 678 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E431941 [] (trimmed) TTGGAATGTTGCGATGCAAGTTATCGTGAAGCCTTGTATTGTGAATAACATTTGTGGTGTATATGGCTTTTGCCAATCACCTAATAATAACGAAG
TCAATTGTAGTTGCTTGCCAGGCTATTCTCCAAGGGATCAGTACACTCCATCTAAGGGATGTTATCCGAATGAAATGAAAGATTTTTGTGATCCG
AATTCTTCCCTTTCGGATGTCTACATTGAAAGGATCTCTAATGCTGATTTCCCTAATAGGATGTATTCTGAACTAGAAAGGGTATTTGATACTAC
AGAGGAGCTTTGCAGGCAGGAAGTGTTGAATGATTGTCTTTGTGAGGCAGCTGTTTTTAATGATTCAACATGTTTCAAGAAGAGGATGCCTATAC
AGAATGCCAGAAGTATTAATCCTGATACAAATAACATGGTTGCATTTCTTAAAATTAGCAACTCTTCGATAACTCAATGCAAAAAGCACTCTGTC
TCAAAGGGTGTTTTGGTAGCAGGTGTGACAGTATTTTCAGTACTCGCTCCGCTTTTTGCAGCAATTGCTATATATTATCACCCTTTTGTGAAGAA
ATATAGAGATGCCAAAACCCCTCCGAAAAGAAAGGCAATTGAGATGAATTTAAGGGCATTTTCGTTCCAGCAGCTGCACGAAGCCACCAACAGTT
TCAAGAATAAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431941] SGN-U285461 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284078 [Download] [View] Facility Assigned ID: STMIN11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5