EST details — SGN-E432093

Search information 
Request: 432093Match: SGN-E432093
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279528Clone name: STM-56-D5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279528 [STM-56-D5] Trace: SGN-T284231 EST: SGN-E432094 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432093Length: 193 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E432093 [] (trimmed) GGTTGAAGGGTGGGGTGGGGGTGTTTCTGTTCATTTTTTGAATTCTTTGCTTTTGTATATATATACAGTTCTTGTCACATCAAACCAATAAACCC
ATGCCAATGCAGGCATTGTGGTGATAGCTGATGAACATTGATATTTATTTCCTTCAAAAATCCTTATAAAAAGTGTTCTGGAATTTAAAAAAAAA
AAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432093] SGN-U270529 Solanum tuberosum Build 4 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284230 [Download] [View] Facility Assigned ID: STMIO15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5