EST details — SGN-E432144

Search information 
Request: 432144Match: SGN-E432144
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279645Clone name: STM-56-J13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279645 [STM-56-J13] Trace: SGN-T284282 EST: SGN-E432145 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432144Length: 766 bp (854 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E432144 [] (trimmed) CAAATACCCACTTGCTAGAATCCCAAAATCTTCCAAGAATCTCTCACTCCATTGGAATTATCAAATAAGTTTGCATACCCATGTCTCGTTTTGCT
CTAAAAATGAAATCTTTGAAGAATTTAGGACTACCCAGTTGGATGAATTGCCTGAAAGTGAAGAGCTTGAATTACATAATAAGCCATATTTAAAG
CAAATAGATAATGGGGTTGTCTCAGATGTAGAGGAGGAGCAGAAAAAAGTTAGTAAAGATGAAGTTTTGGAGCCATTTTATAAGTTATTTAAGCC
TACAGAGTCTAATGAAGAAGAAAGTGATACAGAACAAGAGGAAGAGGTTCATCCAGTTGTAGAAGAGAGTAAGAAGGTTAGTGTGGAGTATTATG
AACCGAAACCGGGTGATTTGGTGGTAGGTGTTGTGGTTTCGGGGAATGAGAATAAGCTTGATGTGAGTGTTGGTGCTGACCTATTGGGTACCATG
TTAACTAAGGATGTTTTGCCTTTGTATGACAAAGAGATGGGCTATTTGCTGTGTGATTTAGAGAAGGATGCTGAGGAATTTTTGGTGAGAGGGAA
AATGGGAATTGTGAGCTACGATGATGCAATTAGTGGGGAATCAACGTCAGGGAAGCCCGTTGTGGAACCTGGGACTGTACTTTTTGCTGAGGTTC
TTGGAAGAACTCTCAGTGGTCGACCACTACTGTCAACAAGAAGACTCTTTAGACGCATTGCCTGGCATCGAGTGAGATTAAACAACTAAATGAAC
CTATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432144] SGN-U278507 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284281 [Download] [View] Facility Assigned ID: STMIO55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5