EST details — SGN-E432145

Search information 
Request: 432145Match: SGN-E432145
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279645Clone name: STM-56-J13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279645 [STM-56-J13] Trace: SGN-T284281 EST: SGN-E432144 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432145Length: 626 bp (856 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E432145 [] (trimmed) CAATGGGACTTATTACTCAGTTCAGTAAAGAATATAACTGGGATTTTGAACAATGGTACTTTGTCATGGATGCTATCTAAGGACCTAAAGACGTG
CCGAAAGGATATACAGTTCGATACATTTTTAGTGTGGGGATTATTCCATGTTTACATTATCCCTTTCAAACTTGAACCATTTCCAATTAGCATAC
ATATTTTCTTCATCTTCAAATGGAAGCCTGTCGGTTGGAAGGGGTTCCGGTTTCTTTGTTGCTGAAACAGTTGGTAGGTTCTGTCTGAACTTCTT
CGCCATCTGTTTTGCTTCAGAAAATACTCTCTCCTTGTCCGATAAAAATAACCCTGGCTCGCTTTCAAGGTTTGCAATACTGAGAGATATTTTGT
CAGGAAACATTGACTTCACAACCATAACTTTCACCTTCTCATCAACTGCTAACAAGTTACTCATGGAAGTAACCTTGGATTGGGTGACATTTGAG
ATGTGTAGCAAGCCACTCTCCTGCTTCTTAAACATATGCACATGCATGATGCATCCAGAGTTCCATCGTAAGGGCACTACAGAAATAGATATAAT
AATCCAATACAAGTATAGATCTGTGATAAAATAAGGCAATCCCACAAATTTTACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432145] SGN-U268966 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284282 [Download] [View] Facility Assigned ID: STMIO55TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0038 Quality Trim Threshold: 20.5