EST details — SGN-E432312

Search information 
Request: 432312Match: SGN-E432312
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279644Clone name: STM-56-J12
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432312Length: 764 bp (873 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E432312 [] (trimmed) TGTTTCAAATAGAAAGTATGCATTGAATTCAATATTTAATCTCTTATATAAAGCTCATTCGATATGAGGGAGATAATAGCTAAGGAGAAAAGAAA
AGATGGCTGAGTTCATTGAAGATACAAATACAAAGAACAAGAATGAAGATCCATCCATAAGCCTTGTTTCTGATGGAAAATCTTCTAGTGAACCA
TCAAAAAATGACCAAGTAGTAGAAACACAACCAGAAAATAGTACACAAAATCAAGAAAAAGAAAATATTATTGCTCAACAAGGCCAAGAAGAAGA
GGAGGAGATGAATGCTAATGATGAGGAAAGAGCAAATTTTTCAACACCTCCAGGAAAAAGATCAGCTCCTAAACCTAAGACGGGTTGAAATTAAT
TAATTAATTAAGTCTTTGGGAATTCCAATATTGTGATAATTATTTCAAGAAACCTAGTTGTTTTCTAGGTTTTTTTTTTTGGTTTGTTCTTCTCA
TTTTTAATATTGTAATTTGTAATGGTTAATTCTTCTTGGTTCTTTGTTTGTTTTGCTCATTTTTTATGGTTAATCTGTTTTAAAAAGAATGTCAT
AAGAAATAATTTGATTTTAAAATTCTTTAGTTCAAAATTAGAAGGTTTAAAAATTAAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTCTCTCT
CCAACAAATTCATTTTCTACTCACAATTTCTTCACTTTCTCTCTCTAGAACTAGAAAAAAATGGCGATCAAGGTCCATGGCCCTATGATGTCCCC
TGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432312] SGN-U268920 Solanum tuberosum Build 4 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284449 [Download] [View] Facility Assigned ID: STMIP54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5