EST details — SGN-E432550

Search information 
Request: 432550Match: SGN-E432550
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280140Clone name: STM-57-O17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280140 [STM-57-O17] Trace: SGN-T284686 EST: SGN-E432549 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432550Length: 345 bp (858 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E432550 [] (trimmed) CTCCTTTTTTTTTGAGGCAAAAGACAGATATCATCTGAAGTCCCNTTTCTGTCAAACAAATGAAATGGGCCTTGCATGAAGCTTTTTATAATATA
GAACCAAATACGTCCTTTTATTATCATTGAAGTCCCTTTCCATCAAACAAATCGATGTCTTTTGACGGAAAACGGTCTTCAATGAATCTTCTTAC
ACTAAAAAATCAATTATATACCATCATCGGATTTTTGAATATTGAAAAAGGATAGTACAGTAGACTTGCCTAGTTAATTAAAAATCATCCGTAAA
TGGCATGATTTGATCGCTGCTAGGCTAAATAATGCTTGAATCCTGAAAAGGAGGTCAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432550] SGN-U273059 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284687 [Download] [View] Facility Assigned ID: STMIQ93TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0108 Quality Trim Threshold: 12.5