EST details — SGN-E432566

Search information 
Request: 432566Match: SGN-E432566
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279808Clone name: STM-57-A14
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279808 [STM-57-A14] Trace: SGN-T284704 EST: SGN-E432567 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432566Length: 716 bp (957 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E432566 [] (trimmed) GGCAGGCTGTCCTCGCATCATTCACAGAGATATTAAGTCACCTAACATTCTTTTGGATAACAACTTTGATGCTCGGGTTGCTGATTTTGGATTAG
CTAAATTAGCTCAGGATGCAAAAAGCCATGTTACAACACGTGTAATGGGTACCTTTGGATACATGGCCCCTGAATATGCATCCAGTGGAAAGCTG
ACTGAAAAATCCGATGTATTTTCCTTTGGAGTTGTGCTTCTGGAGCTAATTACTGGACGGAAGTCTGTGGATGCATCTCAGCCTTTGGGGGAGGA
AAGTCTAGTTGAGTGGGCTCGACCTTTGCTTGGTAATGCACTTGAAAAAGAGGAATTTAATCAGTTGACAGATCCTCGCCTTGGGAATAATTACA
TTGACAGTGAGATGTTTCGAATGATTGAGATTGCTGCAGCTTGTGTGCGTCACTCAGCTGCAAAGAGACCAGGGATGGGACAGATCATGAGAGCT
TTTGATAGTATGCTAATGTCTGATTTGACAAACGGGATGAAAGTTGGTGAAAGTGCAATATATAACTCTGCTGAGCAATCTGCACAGATAAGATT
GTTTCGAAGGATGGCATTTCCTAGTCAAGATGTTAATTCAGATTTTTCAAGTCAAAGCACCAATTATAGTAGAGAGTTGTCTGAACATGTTTAGA
TGAAACATCTGNTAATATATCAAAGGCTGCTTTAGCTGAGAGGTACATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432566] SGN-U281425 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284703 [Download] [View] Facility Assigned ID: STMIR07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0125 Quality Trim Threshold: 12.5