Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E432604

Search information 
Request: 432604Match: SGN-E432604
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279917Clone name: STM-57-E6
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279917 [STM-57-E6] Trace: SGN-T284742 EST: SGN-E432605 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432604Length: 715 bp (992 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E432604 [] (trimmed) TTCAGCTGCTGTTGCCACTCGCGCCAATGGTGCACAAGCCAGCATGGTTGCCCCCTTCACTGGACTCAAGTCCGCCGCCTCTTTCCCTGTTTCAA
GGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAATGGTGGAAGAGTCAGATGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAG
ACTCTATCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAAGGAAGTTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGA
GACTGAGCACGGATTTGTGTACCGTGAGAACAACAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTTGGGT
GCACTGATGCAACCCAGGTCTTGGCTGAGGTGGAGGAGGCAAAGAAGGCTTACCCACAGGCATGGATCCGTATCATCGGATTCGACAACGTTCGT
CAAGTGCAGTGCATCAGTTTCATTGCCTACAAGCCAGAAGGATACTAAATTTCATCAAACCTATAATTAATTACTCCTATGTTTNGTTTGATTTG
TACCTAGTCTTTTTTTAAAAAAAAATACCCCTACTGGTTTTTGCNGTTTGTACCGGTGTATTTTCCTCCGATCCGACCAAGTTATGAGAATATAA
TAATGATTGATCGGTGCTTATAAGTTTTTTTTAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432604] SGN-U281361 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284741 [Download] [View] Facility Assigned ID: STMIR27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.990 Expected Error Rate: 0.0241 Quality Trim Threshold: 12.5