EST details — SGN-E432607

Search information 
Request: 432607Match: SGN-E432607
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279919Clone name: STM-57-E8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279919 [STM-57-E8] Trace: SGN-T284743 EST: SGN-E432606 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432607Length: 722 bp (879 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E432607 [] (trimmed) ACTTTTTTTTTTTTNCAGAAAGGAAGGATGAGCTGCATTAACAAGGTAAAAGTTACAATGTAAAGTAGATGATTCTTAACTTTACACAACAGACT
TCCTTGCAACCAACATATGACAAAATTATCACACTAAGACTGAAAATCAGAGCTTGGAAAGGAACAACAGAAAACAAGTCTTCATGAAATCATAC
ATAACAGCATTGCTGGCTGCACTTCTCCACTCTAATATTCCTAACATAGGTTAGAATATGACTTTAACCAAGGGGGGGGGACCTGGTCAAGCCTC
TTTATCCTCGGATTACCTCCCGGGAGCAGCCTATTAGCTTTGCCATAAATGCACTCACATCTCGACAATAGATGGAAGTTATCGCAAAAAACAGC
ACTTGGCAGACAATAGATATTGCTCTCCATCACATTTATAAGAAGTAATCAGGGGTTCTTCGTGTTACATCCGGTTCTCCCCTTCTTGGAGCTGG
ATCAAACTGGATAAATGTGTGCCCTCTGCAGTCATCAACTTCCAAAATAGAGGCCATGTTTCCACATCGATAACAATAATTTGGTGCACTAAAAA
TAGTGACGACTTTTTGTTCATGGCTCCAGTTATATCCCTCCATAACCAGCTGATGAGCTCGAGCAATCAGCTTTAGATTATTGGTATGGTGAAAT
TGCTCAGATATGTCCTGCCCAAAAGTGTATCCAGCACCCCGGGGTGACATACCCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432607] SGN-U271524 Solanum tuberosum Build 4 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284744 [Download] [View] Facility Assigned ID: STMIR28TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0141 Quality Trim Threshold: 14.5